M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant from Promega

Product Specs
ItemM-MLV Reverse Transcriptase, RNase H Minus, Point Mutant
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM3683
Quantity50,000u
Molecular Weight~105kDa

Add to Compare List

Promega

2800 Woods Hollow Rd.

Madison, Wisconsin

United States

Phone: 800-356-9526
Fax: 800-356-1970

Company Profile

Website: http://www.promega.com

(1) Biphasic function of GSK3β in gefitinib‑resistant NSCLC with or without EGFR mutationsExperimental and Therapeutic MedicineSeptember 4, 2023Junzhe Li, Xiayu Wu, Xiang-Bo Ji, Changhao He, Shijie Xu, Xianhua Xudouble-stranded cDNA synthesis using M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant (cat. no. M3683; Promega Corporation) and NEBNext Ultra II Non-Directional RNA Second Stand Synthesis Module (cat. no.

(2) Translocation of Oocytic HES1 into Surrounding Cumulus Cells in Bovine: Mechanism of Cellular Interaction during IVM?International Journal of Molecular SciencesJuly 25, 2023Ralf Pöhland, Jens Vanselow, Fabiana Melo SterzaThe cDNA synthesis was performed with M-ML reverse transcriptase and ribonucleaseRNase inhibitors (M3683 and N2515, Promega Mannheim, Gemany) using oligo- (dT) primers (2 ng/μL, #10814270001) mixed with random

(3) Tacedinaline (CI-994), a class I HDAC inhibitor, targets intrinsic tumor growth and leptomeningeal dissemination in MYC-driven medulloblastoma while making them susceptible to anti-CD47-induced macrophage phagocytosis via NF-kB-TGM2 driven tumor inflammationJournal for ImmunoTherapy of CancerJanuary 10, 2023Viktoria Marquardt, Johanna Theruvath, David Pauck, Daniel Picard, Nan Qin, Lena Blümel, Mara Maue, Jasmin Bartl, Ulvi Ahmadov, Maike Langini, et al.Promega), and complementary DNA (cDNA) was synthesized from 0.5 µg RNA using M-MLV Reverse Transcriptase (#M3683, Promega) according to the manufacturer’s instructions. Quantitative real-time PCR was performed using

(4) Macrophage innate training induced by IL-4 and IL-13 activation enhances OXPHOS driven anti-mycobacterial responseseLifeSeptember 29, 2022Mimmi L E Lundahl, Morgane Mitermite, Dylan Gerard Ryan, Sarah Case, Niamh C Williams, Ming Yang, Roisin I Lynch, Eimear Lagan, Filipa M Lebre, Aoife L Gorman, et al.,Thermo Fisher Scientific,Cat# 12881630, "Peptide, recombinant protein",M-MLV reverse transcriptase,Promega,Cat# M3683, "Peptide, recombinant protein",Recombinant human IFNγ,Peprotech,Cat# 300–02, "Peptide, recombinant

(5) AZFa Y gene, DDX3Y, evolved novel testis transcript variants in primates with proximal 3´UTR polyadenylation for germ cell specific translationScientific ReportsMay 27, 2022P. H. Vogt, M-A. Rauschendorf, J. Zimmer, C. Drummer, R. BehrC1101) by reverse transcription (RT) with the Promega M-MLV Reverse Transcriptase enzyme (Cat. No. M3683) following the manufacturer’s recommendations. About 1 μg of total RNA was used in each RT reaction.

(6) Environmental control of Pub1 (NEDD4 family E3 ligase) in Schizosaccharomyces pombe is regulated by TORC2 and Gsk3Life science allianceMay 1, 2022Wang T, Woodman P, Humphrey SJ, Petersen J.synthesized from 500 ng of RNA by using M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant (Cat. no. M3683; Promega). DNAse-treated RNA, 500 ng Oligo (DT)15 (Cat. no. C1101; Promega) and 100 ng random hexamer

(7) Ablation of glucokinase-expressing tanycytes impacts energy balance and increases adiposity in miceMolecular MetabolismNovember 1, 2021Antoine Rohrbach, Emilie Caron, Rafik Dali, Maxime Brunner, Roxane Pasquettaz, Irina Kolotuev, Federico Santoni, Bernard Thorens, Fanny Langletrespectively. Approximately 250 ng of RNA was then reverse-transcribed using the M-MLV reverse transcriptase (M3683, Promega) following the manufacturer's instructions. cDNAs were diluted (1:10), and qPCR was performed

(8) The long non-coding RNA HOTAIRM1 promotes tumor aggressiveness and radiotherapy resistance in glioblastomaCell Death & DiseaseOctober 1, 2021Ulvi Ahmadov et al.Madison, WI, USA). Reverse transcription of total RNA (1 µg) was carried out using the MMLV-RT kit (#M3683, Promega) with random hexamers. Real-time quantitative PCR (RT-qPCR) was subsequently performed with

(9) Enriched Alternative Splicing in Islets of Diabetes-Susceptible MiceInternational Journal of Molecular SciencesAugust 10, 2021Ilka Wilhelmi, Alexander Neumann, Markus Jähnert, Meriem Ouni, Annette Schürmanntotal RNA preparation. Subsequently, cDNA synthesis was conducted with M-MLV reverse transcriptase (M3683, Promega, Fitchburg, WI, USA) and Abcc8-specific reverse primer (R- 5′GATCTCCATGTCTGCCAGGT3′). The PCR

(10) The ARFRP1-dependent Golgi scaffolding protein GOPC is required for insulin secretion from pancreatic β-cellsMolecular metabolismMarch 1, 2021Wilhelmi I, Grunwald S, Gimber N, Popp O, Dittmar G, Arumughan A, Wanker EE, Laeger T, Schmoranzer J, Daumke O, et al.Qiagen RNeasy MinElute Kit according to the manufacturer's instructions. cDNA was generated using M-MLV (M3683) reverse transcriptase from Promega. Gene expression of Arfrp1, Snap25 and insulin was measured by RT-qPCR

(11) Meiotic sex chromosome cohesion and autosomal synapsis are supported by Esco2Life science allianceMarch 1, 2020McNicoll F, Kühnel A, Biswas U, Hempel K, Whelan G, Eichele G, Jessberger R.transcription was performed using M-MLV reverse transcriptase (RNase H minus, point mutant Cat. no. M3683; Promega) and Oligo(dT)15 primers (Cat. no. C1101; Promega) according to the manufacturer’s protocol.

(12) LAG-3 Inhibitory Receptor Expression Identifies Immunosuppressive Natural Regulatory Plasma CellsImmunityJuly 17, 2018Lino AC, Dang VD, Lampropoulou V, Welle A, Joedicke J, Pohar J, Simon Q, Thalmensi J, Baures A, Flühler V, et al.Kit,Roche,Cat. #11787896001 "M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant",Promega,Cat. #M3683 Agilent High Sensitivity DNA Kit,Agilent,Cat. #5067-4626 Pfu polymerase,Promega,Cat. #M7745 Hot Taq

(13) T Lymphocytes Influence the Mineralization Process of BoneFrontiers in immunologyJanuary 1, 2017El Khassawna T, Serra A, Bucher CH, Petersen A, Schlundt C, Könnecke I, Malhan D, Wendler S, Schell H, Volk HD, et al.5× Reactionbuffer, Promega, N2511; M-MLV Reverse Transcriptase RNase H Minus, Point Mutant, Promega, M3683; Ribonuclease H, Promega, M4285]. Primers were tested for the annealing temperature and efficiency prior

(14) Expression and knockdown of zebrafish folliculin suggests requirement for embryonic brain morphogenesisBMC Developmental BiologyDecember 1, 2016Emma J. Kenyon, Monique N. H. Luijten, Harmeet Gill, Nan Li, Matthew Rawlings, James C. Bull, Yavor Hadzhiev, Maurice A. M. van Steensel, Eamonn Maher, Ferenc Muellerwas produced using M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant (Promega M3681, M3682, M3683) and oligodT primers (Invitrogen). Zebrafish flcn cDNA was amplified using the following forward primer

(15) Diurnal regulation of hypothalamic kisspeptin is disrupted during mouse pregnancyJournal of EndocrinologyJune 1, 2016Cassandra C Yap, Michaela D Wharfe, Peter J Mark, Brendan J Waddell, Jeremy T SmithMoloney Murine Leukemia Virus Reverse Transcriptase, RNase H Minus, Point Mutant (M-MLV RT (H–)) (Promega, cat# M3683). The resultant cDNAs were purified using the UltraClean PCR Clean-Up Kit (MoBio Laboratories, Carlsbad,

(16) Complex transcriptional control of the AZFa gene DDX3Y in human testisInternational Journal of AndrologyFebruary 1, 2011M.-A. Rauschendorf, J. Zimmer, R. Hanstein, C. Dickemann, P. H. VogtMannheim, Germany; cat. no. C1101) by RT with the Promega M-MLV reverse transcriptase enzyme (cat. no. M3683) following the manufacturer’s recommendations. About 1.3 μg of total RNA (producing ∼26 ng of cDNA from

(17) Maedi-Visna virus was detected in association with virally exposed IVF-produced early ewes embryosTheriogenologyMarch 25, 2010C. Cortez Romero, J.L. Pellerin, N. Poulin, Y. Cognié, Y. Chebloune, M. Pépin, F. Fieni

(18) Dysregulation of Ribosome Biogenesis and Translational Capacity Is Associated with Tumor Progression of Human Breast Cancer CellsPLoS ONESeptember 25, 2009Stéphane Belin, Anne Beghin, Eduardo Solano-Gonzàlez, Laurent Bezin, Stéphanie Brunet-Manquat, Julien Textoris, Anne-Catherine Prats, Hichem C. Mertani, Charles Dumontet, Jean-Jacques DiazMA- and MP cells, in the presence of 200 units of M-MLV reverse transcriptase, RNase H minus (Promega M3683), 40 units of RNasin Ribonuclease inhibitor (Promega N2515), 1 µM of each reverse primer targeting a

(19) Detection of ovine lentivirus in the cumulus cells, but not in the oocytes or follicular fluid, of naturally infected sheepTheriogenologyMarch 12, 2006C. Cortez Romero, F. Fieni, C. Roux, P. Russo, J.M. Guibert, F. Guiguen, Y. Chebloune, M. Pépin, J.L. Pellerin

Be the First to Write a Review!